1× SSC and 0.1 DTT) and immersed several times in MilliQ/DI water before being allowed to spin dry. The washed slides were scanned using a GMS 418 GDC-0449 in vivo Array Scanner (Genetic MicroSystems) and fluorescence was quantified using ImaGene v7.5 software (BioDiscovery). Analysis was carried
out as previously described [39]. Each time point was normalized to the expression in LB broth without NaCl prior testing with statistical analysis. RT-PCR The RNA extracts used in the microarray experiments were used to confirm the results obtained from microarray studies using the SuperScript III one-step RT-PCR system (Invitrogen). All genes were amplified using gene specific primer pairs (Table 4) using the following conditions: 95°C (for 45 s), 58°C (for 45 s), and 72°C (for 30 s) for 25 cycles. Amplification of the 23 S rRNA TGF-beta inhibitor gene using
23 s F and 23 s R primers (Table 4) was included as a control. The experiments were performed in duplicate and analyzed for band intensity by densitometry using GeneSnap/GeneTools software (Syngene). Table 4 Oligonucleotide primers used for RT-PCR. Primer Names Oligo Sequences (5′-3′) Purpose BPSS2232 F CGGACTTCGACACCGACGCGCTGA Forward primer for BPSS2232 BPSS2232 R CGTGTGCCAGTCGCTGCCCGCGTA Reverse primer for BPSS2232 BPSS1272 F GGCACGAAGGAAGTCATCAA Forward primer for BPSS1272 BPSS1272 R CGACGCAGTATCTCCAGCTC Reverse primer for BPSS1272 BPSS2242 F GTGAGCCGCTACGAGGAC Forward primer for BPSS2242 BPSS2242 R ACGCCCCAGTAGTTCGTATC Reverse primer for BPSS2242 BopA F GTATTTCGGTCGTGGGAATG Forward primer for bopA BopA R BI 2536 in vitro GCGATCGAAATGCTCCTTAC
Reverse primer for bopA BipD F GGACTACATCTCGGCCAAAG Forward primer for bipD BipD R ATCAGCTTGTCCGGATTGAT Reverse primer for bipD BopE F CGGCAAGTCTACGAAGCGA Forward primer for bopE BopE R GCGGCGGTATGTGGCTTC G Reverse primer for bopE 23S F TTTCCCGCTTAGATGCTTT Forward primer for 23S rRNA 23S R AAAGGTACTCTGGGGATAA Reverse primer for 23S rRNA Preparation of total and secreted protein and Western blotting An overnight-culture of B. pseudomallei grown in salt-free LB broth, was centrifuged and the bacteria washed in salt-free medium to remove secreted proteins. this website The OD600 was adjusted to 0.5 then the washed bacteria subcultured 1:10 into LB broth containing 0, 170 or 320 mM NaCl and incubated at 37°C for 6 hrs. After centrifugation, bacterial pellets were lysed with Laemmli buffer to release intracellular proteins. Secreted proteins were isolated from identical volumes of 0.45 μM-filtered supernatants from the centrifuged cultures by using Strataclean beads (Stratagene). The supernatants were confirmed to derive from cultures containing identical numbers of viable bacteria, therefore protein levels are not anticipated to reflect cell lysis. Proteins were separated by SDS polyacrylamide gel electrophoresis and transferred to PVDF membrane.