For co-cultures of BEN2908 and its ΔJI isogenic deletion mutant or of BEN2908 and its Δfrz deletion mutant in chicken serum or in IF0 minimal medium (100 mM NaCl, 5 mM NH4Cl, 2 mM NaH2PO4·H2O, 0.25 mM NaSO4, 0.05 mM MgCl2, 1 mM learn more KCl, 30 mM triethanolamine-HCl, pH 7.3) containing 5 mM as a sole carbon source,

a similar protocol was followed, but the overnight cultures were first centrifuged at 4000 g for 10 min. Bacteria were then washed three times with phosphate-buffered saline (PBS) (137 mM NaCl, 2.7 mM KCl, 2 mM KH2PO4, 10 mM Na2HPO4, pH 7.4) or IF0 and resuspended in the same volume of PBS or IF0 before being inoculated either in chicken serum (Sigma-Aldrich) previously decomplemented by 30 min of incubation at 56 °C and containing nalidixic acid or in IF0. Standard DNA manipulation techniques were carried out as described by Sambrook & Russell (2001). Plasmid and E. coli chromosomal DNA were purified using the Nucleobond PC100 and Nucleospin tissue kits according to the manufacturer’s protocol (Macherey-Nagel). For the extraction of total RNA, bacterial cells taken in the mid-exponential phase of growth were first treated with RNA Protect (Qiagen). The stabilized RNAs were then extracted using an RNA Pure Yield kit (Promega). Bacteria were transformed by electroporation following the

method of Tung & Chow (1995). For Southern blot hybridization, DNA restriction fragments were subjected to electrophoresis and transferred to a Hybond-N+ membrane (Amersham, GE Healthcare

Life Sciences). Probes were labeled with peroxidase, and check details hybridized DNA fragments were revealed using an enhanced chemiluminescence kit (RPN3000; Amersham Pharmacia Biotech), as described by the manufacturer. Unless otherwise stated, PCR amplification was performed in a mixture with a 50-μL total volume containing 1 μM of the forward and reverse primers, 200 μM of each dNTP (Finzyme, Ozyme, France), and 1.25 U of Taq DNA polymerase (New England Biolabs Inc.) in a PCR buffer containing 10 mM KCl, 10 mM (NH4)2SO4, 2 mM MgSO4, 0.1% Triton X-100, 20 mM Tris-HCl, pH 8.8 (New England Biolabs Inc.). Amplifications were performed in a Perkin-Elmer thermocycler (GeneAmp 9700; Applied Biosystems) with the following temperature program: one cycle of 45 s at 95 °C; 30 cycles of 45 s Dichloromethane dehalogenase at 95 °C, 60 s at temperature 5 °C lower than the average Tm values of the primers, and 1 min kb−1 at 72 °C; and finally, one cycle of 10 min at 72 °C. RT-PCRs were performed on RNAs purified during the exponential phase of growth, as described previously (Gilot et al., 2000). In brief, after treatment with DNase I, total RNA was reverse transcribed with Moloney murine leukemia virus reverse transcriptase (Invitrogen) and the reverse primers of interest (Yici-as, caccagggcagtaaagcgctct; C4488-5as, ccagccattgctcaagtaaacgtaaa; C4488-6as, tgataaagtagcgttctgacaattt).