Emergency room visits due to benzodiazepine poisoning were identified by ICD-9 code 969.4. The frequencies of patient visits were calculated according to categories of each demographic variable. UK-371804 manufacturer Chi-square

tests were used to assess the difference of emergency room visits among categories of each demographic variable. A multiple logistic regression analysis was performed, where the outcome variable was emergency room visits due to benzodiazepine poisoning (yes/no), and the independent variables were the demographic variables. Key findings  Of 1 317 566 emergency room visits over the 7-year period, 562 were due to benzodiazepine poisoning. Seventy-seven per cent of these visits were made by patients who were white, of whom 53% were 30–49 years old, 56% were female, 74% had health insurance and 44% lived in zip codes with median family see more incomes of $40 000–59 999. Chi-square tests were significant for racial group, age and annual income (P < 0.01). In the logistic regression white patients were 73% more likely than black patients to have emergency room visits caused by benzodiazepine

poisoning (P < 0.01), with an odds ratio (95% confidence interval) of 5.63 (4.33–7.30). Compared with those aged 0–19 years, the odds ratio for patients aged 30–39 to have such visits was 2.73 (2.09–3.57), and the odds ratio for patients aged 40–49 was 2.84 (2.17–3.71). Conclusions  White patients and patients aged 30–49 years were at

higher risk for emergency room visits due to benzodiazepine poisoning. Health interventions such as medication review by pharmacists may reduce the risk of benzodiazepine poisoning for these patients. “
“Objectives The aim was to evaluate the awareness and implementation of the Smoking Cessation Clinical Practice (SCCP) guidelines. Methods A self-reported questionnaire based on the updated version of the SCCP guidelines was completed by 422 healthcare providers (HCPs) including physicians, dentists, dental hygienists and pharmacists recruited from both public and private sectors in Jordan. Key findings The majority of HCPs reported good smoking-cessation practices. However, their awareness about the SCCP guidelines was inadequate. Approximately 68% of HCPs lacked knowledge of the 5As; about 74% lacked knowledge of the 5Rs of the these clinical guidelines for smoking cessation, which are the principal guidelines for smoking intervention and motivation to quit smoking. Fortunately, about 70% of participants from all groups examined and applied most of the steps in the guideline spontaneously without previous knowledge of the guideline. This spontaneous practice could be due to their vast practical experience, and the use of logic and/or basic knowledge about smoking cessation. Compared to physicians, pharmacists and dental hygienists showed significantly more frequent practice of most steps with patients willing to quit smoking.

, 2001; Werling & Jungi, 2003; Doherty & Arditi, 2004). In our study, the expressions of TLR2 and TLR4 were increased in both tuberculosis and healthy control groups 3-h poststimulation; however, only TLR2 expression showed a significant difference (P≤0.05) between the two see more groups. The increase in the expression of the TLR2 gene is more significant in healthy cattle (6.54-fold)

response to stimulation than the tuberculosis group (2.64-fold). This demonstrates that the TLR2 signal pathway may play a larger role in healthy control cattle than the tuberculosis group, possibly resulting in a more efficient proinflammatory gene activation. An important anti-inflammatory cytokine, IL10, was also examined in our study. IL10 downregulates the Th1 type immune response and upregulates the Th2 type in pathogen–host interaction (Jacobs et al., 2000). It has been shown in previous studies, in both humans and mice, that increased

expression of IL10 is associated with the decreased ability of macrophages to restrict the growth of intracellular Mycobacterium (Jamil et al., 2007; Bilenki et al., 2010). Our results show that IL10 expression is more increased in tuberculosis cattle (8.74-fold) than the healthy group (2.90-fold) relative to 3-h poststimulation compared with nonstimulated cells. The differential regulation of IL10 in tuberculosis cattle may reflect vulnerability in the defense of macrophages against M. bovis. The development trend of gene expressions in this study is consistent with that seen by Meade NU7441 and colleagues, while the different levels of gene expression seen could be attributed to cell populations (PBMCs vs. MDMs), stimulator (bovine tuberculin vs. M. bovis) or comparison of different clinical phenotypes [active BTB infection vs. Latent TB (LTB)]. Our study provides evidence of differences in gene expression between tuberculosis and healthy cattle, which confirms that the innate immune response, TLRs signal pathway

and Th1/Th2 bias are important in BTB infection. The current techniques cannot predict the risk of an individual LTB animal developing into the active disease, and genes implicated in susceptibility and BCKDHA resistance of tuberculosis in cattle cannot point to clear solutions. Building on the differences in gene expression regulation demonstrated in this study, it may provide insights into the diagnosis and treatment of tuberculosis cattle and lead to diagnostics that may characterize the immune response prognostic information in BTB infection. This work was supported by the key project of Ministry of Agriculture, China (Project no. 2009ZX08009-183B), the Beijing Science Foundation of China (Project no. 6101002) and the Natural Science Foundation of China (Project no. 30972164). Y.W. and X.Z. contributed equally to this work. Table S1. Data of IFN-γ ELISA assays (shown as values of optical density at 450 nm, OD 450 nm). Table S2.

In this study, a soil-borne, glyphosate-resistant bacterium was selected and identified as Enterobacter. The EPSPS in this strain was found to have Cabozantinib in vivo been altered to a resistant one. A total of 42 differentially expressed genes (DEGs) in the glyphosate were screened using microarray techniques. Under treatment, argF, sdhA, ivbL, rrfA-H were downregulated, whereas the transcripts of speA, osmY, pflB, ahpC, fusA, deoA, uxaC, rpoD and a few ribosomal protein genes were upregulated. Data were verified by quantitative real-time PCR on selected

genes. All transcriptional changes appeared to protect the bacteria from glyphosate and associated osmotic, acidic and oxidative stresses. Many DEGs may have the potential to confer resistance to glyphosate alone, and some may be closely related to the shikimate pathway, reflecting the complex gene interaction network for glyphosate resistance. “
“Yersinia polynucleotide phosphorylase (PNPase), a 3’-5’ exoribonuclease, has been shown to affect growth during several stress responses. In E. coli, PNPase is one of the subunits of a multi-protein complex known as the degradosome, but also has degradosome-independent

functions. The carboxy–terminus of E. coli ribonuclease E (RNase E) serves as the scaffold upon which PNPase, enolase (a glycolytic enzyme), and RhlB helicase all have been shown to bind. In the yersiniae, only PNPase has thus far been shown to physically interact with RNase GSK-3 activity E. We show by bacterial two-hybrid and co-immunoprecipitation assays that RhlB and enolase also interact with RNase E. Interestingly, although PNPase is required for normal growth at cold temperatures, assembly of the yersiniae degradosome was not required. However, degradosome assembly was required for growth in the presence of reactive oxygen species. These data suggest that while the Y. pseudotuberculosis PNPase plays a role in the oxidative stress response through a degradosome-dependent mechanism, PNPase’s MTMR9 role during cold stress is degradosome-independent.

2012 Federation of European Microbiological Societies. Published by Blackwell Publishing Ltd. All rights reserved “
“To examine why we failed in direct sequencing of rRNA gene internal transcribed spacer (ITS) in Pleurotus nebrodensis, we obtained monokaryons of P. nebrodensis (00489 and 00491) using a protoplast monokaryonization technique. PCR products of ITS amplifications were sequenced. There was a base pair insertion/deletion difference between the two nuclei of P. nebrodensis that led to failure in direct sequencing. Internal transcribed spacer regions (ITS1, ITS2, and 5.8S rRNA gene) of the nuclear ribosomal repeat are widely used in fungal systematics and phylogeny (Gardes & Bruns, 1993; Kårén et al., 1997; Cooke et al., 2000; Manter & Vivanco, 2007; Nilsson et al., 2009).

For co-cultures of BEN2908 and its ΔJI isogenic deletion mutant or of BEN2908 and its Δfrz deletion mutant in chicken serum or in IF0 minimal medium (100 mM NaCl, 5 mM NH4Cl, 2 mM NaH2PO4·H2O, 0.25 mM NaSO4, 0.05 mM MgCl2, 1 mM learn more KCl, 30 mM triethanolamine-HCl, pH 7.3) containing 5 mM as a sole carbon source,

a similar protocol was followed, but the overnight cultures were first centrifuged at 4000 g for 10 min. Bacteria were then washed three times with phosphate-buffered saline (PBS) (137 mM NaCl, 2.7 mM KCl, 2 mM KH2PO4, 10 mM Na2HPO4, pH 7.4) or IF0 and resuspended in the same volume of PBS or IF0 before being inoculated either in chicken serum (Sigma-Aldrich) previously decomplemented by 30 min of incubation at 56 °C and containing nalidixic acid or in IF0. Standard DNA manipulation techniques were carried out as described by Sambrook & Russell (2001). Plasmid and E. coli chromosomal DNA were purified using the Nucleobond PC100 and Nucleospin tissue kits according to the manufacturer’s protocol (Macherey-Nagel). For the extraction of total RNA, bacterial cells taken in the mid-exponential phase of growth were first treated with RNA Protect (Qiagen). The stabilized RNAs were then extracted using an RNA Pure Yield kit (Promega). Bacteria were transformed by electroporation following the

method of Tung & Chow (1995). For Southern blot hybridization, DNA restriction fragments were subjected to electrophoresis and transferred to a Hybond-N+ membrane (Amersham, GE Healthcare

Life Sciences). Probes were labeled with peroxidase, and check details hybridized DNA fragments were revealed using an enhanced chemiluminescence kit (RPN3000; Amersham Pharmacia Biotech), as described by the manufacturer. Unless otherwise stated, PCR amplification was performed in a mixture with a 50-μL total volume containing 1 μM of the forward and reverse primers, 200 μM of each dNTP (Finzyme, Ozyme, France), and 1.25 U of Taq DNA polymerase (New England Biolabs Inc.) in a PCR buffer containing 10 mM KCl, 10 mM (NH4)2SO4, 2 mM MgSO4, 0.1% Triton X-100, 20 mM Tris-HCl, pH 8.8 (New England Biolabs Inc.). Amplifications were performed in a Perkin-Elmer thermocycler (GeneAmp 9700; Applied Biosystems) with the following temperature program: one cycle of 45 s at 95 °C; 30 cycles of 45 s Dichloromethane dehalogenase at 95 °C, 60 s at temperature 5 °C lower than the average Tm values of the primers, and 1 min kb−1 at 72 °C; and finally, one cycle of 10 min at 72 °C. RT-PCRs were performed on RNAs purified during the exponential phase of growth, as described previously (Gilot et al., 2000). In brief, after treatment with DNase I, total RNA was reverse transcribed with Moloney murine leukemia virus reverse transcriptase (Invitrogen) and the reverse primers of interest (Yici-as, caccagggcagtaaagcgctct; C4488-5as, ccagccattgctcaagtaaacgtaaa; C4488-6as, tgataaagtagcgttctgacaattt).

Primates are physiologically and anatomically similar to humans, and thus our results are potentially important for clinical application of UTx in humans. Postoperative management for primates differs from that for humans. Because the appropriate Selleckchem Z VAD FMK concentration of tacrolimus in organ transplantation in cynomolgus monkeys is generally higher than that in humans, we used a higher concentration than that used in humans. It is also

difficult to perform continuous infusion, which made it more difficult to control the blood tacrolimus concentration, which had to be stabilized by p.o. administration. Blood tacrolimus decreased 1–2 weeks after surgery due to anorexia, and gastrointestinal absorption was also poor after surgery, with evidence of possible rejection found in both cases. Because low blood concentrations and rejection were observed, the dose of immunosuppressants was increased. The general condition and appetite

then gradually improved and at 3 weeks the tacrolimus level rapidly increased, perhaps due to enhanced gastrointestinal absorption of the drug. Thus, it was extremely difficult to control the blood concentrations of oral tacrolimus in the cynomolgus monkeys. Furthermore, a limitation of Staurosporine cell line the study was that tacrolimus could not be determined in the test facility and this test was commissioned to an external institution. Consequently, the results had a time lag of several days. This caused further difficulty with the blood concentration control. Rejection diagnosis in solid organ transplantation is mostly performed by biopsy. However, there is no clear procedure for monitoring rejection in UTx. In transplantation of other organs, information Rapamycin mouse on organ dysfunction is obtained from blood samples. However, the uterus is not a vital organ and blood tests cannot be used to determine rejection. Therefore, we used Duplex/Doppler echo and pathological findings

from biopsy of the uterine cervix to monitor possible rejection. Echo findings show whether blood flow in the uterine artery after microvascular anastomosis is decreased by stenosis or thrombus. In case 2, echo immediately after surgery showed blood flow in the right and left uterine arteries, but flow in the right uterine artery could not be detected after 1 month and there was no flow in both uterine arteries after 2 months, because case 2 did not recover from rejection. Moreover, temporal enlargement of the uterus was observed in case 2 on POD 23. This may be a mechanism of rejection similar to that of renal enlargement observed in renal transplantation. Pathological findings show that both animals had initial rejection.

Euclidean distances as dissimilarity between all possible pairs of two visual stimuli were calculated by using the visual responses of the 68 pulvinar neurons. Then, the mds program (proxscal procedure, spss statistical package, version 16) positioned the visual stimuli in the two-dimensional space with the distances between the stimuli representing the original relationships (i.e. Euclidean distances in the present study; Shepard, 1962; Kruskal, 1964). Recordings were made from a total of 401 neurons

from the pulvinar nuclei of two monkeys. One-hundred and sixty-five neurons responded to visual stimuli and, of these, 68 neurons were tested selleck chemicals with all of the visual stimuli. The mean spontaneous firing rate was 12.15 ± 1.14 spikes/s (n = 68; mean ± SEM) and the mean firing rate during stimulus presentation (500 ms) was 24.67 ± 2.50 spikes/s (n = 68). The pulvinar visually responsive neurons showed robust responses especially during the first 100 ms after stimulus onset. Figure 4 shows such an example

of a pulvinar neuron that responded to various visual stimuli. The activity of the neuron increased sharply in response to the onset of the stimuli, then decreased rapidly, and then gradually RO4929097 solubility dmso increased again. This pattern of changes in neuronal activity formed two response phases – an early rapid response phase and a late gradual response phase. This neuron responded strongly to the face-like patterns (Fig. 4G), especially in the late phase. Figure 5A shows response magnitudes Dapagliflozin of the neuron shown in Fig. 4 during stimulus presentation (500 ms) of all of the visual stimuli. There were significant differences in response magnitudes to the various visual stimuli (F48,563 = 5.821, P < 0.001; differential neuron). All of the 68 neurons tested displayed differential responses to the various stimuli (one-way anova, P < 0.05). Furthermore, the neuron responded differentially to gaze direction in M2 and W1 (dotted lines; Tukey test, P < 0.05). In addition, there were

significant differences in mean response magnitudes to the five stimulus categories (F4,607 = 31.36, P < 0.001). Subsequent post hoc tests indicated that mean response magnitude to the face-like patterns was significantly greater than those to the stimuli in the other stimulus categories (Tukey tests, P < 0.001). The overall mean responses indicated that the pulvinar neurons responded stronger to the face-related stimuli (facial photos, cartoon faces, eye-like patterns and face-like patterns) than the non-face stimuli (simple geometric patterns). Figure 5B illustrates the mean response magnitudes of the 68 visually responsive neurons during stimulus presentation (500 ms) to the face-related and non-face stimuli. The mean response magnitude of the 68 visually responsive neurons to the face-related stimuli was significantly larger than that to the non-face stimuli (F1,3330 = 5.76, P < 0.05).

These phage proteins assemble stable, nonspecific pores in the bacterial envelope, allowing phage-encoded lysins (endolysins) to access their substrate (peptidoglycan) (Young & Bläsi, 1995; Wang et al., 2000). Several holin-like proteins are encoded in bacterial genomes including Gram-positive such as Staphylococcus aureus and Bacillus spp. (Loessner et al., 1999; Real et al.,

2005; Anthony et al., 2010), which display a regulatory role in the activity of murein hydrolases, autolysis and spore morphogenesis (Rice & Bayles, 2003). In the Gram-negative bacteria Borrelia burgdorferi, BlyA exhibits a holin-like function promoting the endolysin-dependent lysis and enhancing haemolytic phenotype in animal erythrocytes (Guina & Oliver, 1997; Damman et al., 2000). In addition, Escherichia coli and Salmonella spp. genomes contain SB431542 cell line holin-like genes, but little is known about their function.

GKT137831 mouse In this work, we performed a combination of bioinformatic, genetic and biochemical experiments in order to characterize the STY1365 small ORF of S. Typhi. Bacterial strains and plasmids used in this study are listed in Table 1. Cells were routinely grown in 2 mL Luria–Bertani (LB) broth at 37 °C with shaking. When required, media were supplemented with ampicillin (100 μg mL−1), chloramphenicol (20 μg mL−1), kanamycin (50 μg mL−1) and l-arabinose (2 μg μL−1). Solid media were prepared by addition of 1.5 g w/v agar. The nucleotide sequence from S. Typhi CT18 genome (AL513382) was accessed via the National Center for Biotechnology Information (NCBI) Genome database (http://www.ncbi.nlm.nih.gov/sites/entrez?Db=genome) Cyclooxygenase (COX) and was used to compare STY1365 and both flanking regions with S. Typhimurium DT104

prophage-like element (AB104436, Saitoh et al., 2005). The STY1365 coding sequence of S. Typhi STH2370 strain was sequenced previously and it was shown to be identical to the corresponding genomic region of S. Typhi CT18 (Rodas et al., 2010). Transmembrane domains of STY1365 were analyzed using tmhmm server v2.0 program (http://www.cbs.dtu.dk/services/TMHMM-2.0/). Analysis of STY1365 predicted amino acid sequence (NC_003198.1) was performed using psi-blast program (http://www.ncbi.nlm.nih.gov/BLAST/). Multiple sequence alignments of STY1365 amino acid sequences and EcolTa2 holin of E. coli TA271 (ZP_07522128.1), ESCE_1669 holin of E. coli SE11 (YP_002292944.1), ECDG_01257 holin of E. coli B185 (ZP_06657343.1) and holin 1 of phage ΦP27 (NP_543080.1) were constructed using vector nt suite v.8 software (Invitrogen). For the chromosomal deletion of STY1365, the ‘one step inactivation’ method described by Datsenko & Wanner (2000) was used. Following mutagenesis, the aph resistance cassette was removed by FLP-mediated recombination. The FRT site generated by excision of antibiotic resistance cassette was used to integrate plasmid pCE36, generating a transcriptional lacZY fusion (Ellermeier et al., 2002).

Survival analysis was performed to assess the risk factors for acquiring malaria. Independent variables included age,

gender, country of origin, use of mosquito repellents, use of barrier clothing, compliance with chemoprophylaxis, smoking, consumption of alcohol, accommodation on different floors in the apartment buildings, and building of residence. Univariate analysis was performed by calculation of the incidence rate ratio for each exposure category. Statistical significance for this comparison was then assessed by the Fisher’s exact test, using COMPARE2 software in the WINPEPI statistical package. Kaplan–Meier survival curves were drawn for the effect of chemoprophylaxis Crizotinib mouse living in the ground floor and first floor (Figure 2). Variables that were associated with the risk of contracting malaria (by a significance level of 0.1) were included in the multivariate Cox proportional hazard regression model. To increase the power CP-868596 cell line of analysis, variables that had three categories in the univariate analysis were redivided into two categories. This model was constructed using the forward stepwise method. p Value <0.1 of the maximum likelihood ratio test was chosen as the cutoff value for exclusion of a variable from the model. Cox proportional hazard regression model analysis

was performed with the use of SPSS 17.0 software (SPSS Inc., Chicago, IL, USA). All 104 staff members residing in the hospital compound during November 2008 agreed to participate

in the study. Two workers developed symptoms and signs of malaria within 10 days of their arrival to Equatorial Guinea. Both workers were excluded from the study, as they were considered to be infected outside of the hospital grounds. Between September 2007 and December 2008 noncomplicated falciparum malaria was diagnosed in 13 workers (12.75%). An incidence rate of 15.29 cases/100 person-years was calculated [95% confidence interval (CI) = 6.46–23.14]. Surprisingly, all cases of malaria occurred in workers residing on either the ground floor or the first floor of all five buildings (Figure 3). Of the 13 people diagnosed as having acquired malaria, 10 were living on the ground floor and 3 on the first floor of different apartment buildings. No cases Glycogen branching enzyme occurred on the second and third floors. Survival curves describing acquisition of malaria in people who lived in the ground floor and first floor compared to those living in the second and third floors showed a statistically significant difference (Figure 2, pvalue = 0.006). There was no statistically significant difference in the incidence of malaria between all apartment buildings, and shorter distance of different buildings from the presumed mosquito breeding area was not associated with an increased risk of acquiring malaria (p = 0.204 on a Cox proportional hazard regression model, data not shown).

In N315 and Mu50, the ssl8 levels were similar to each other,

Lumacaftor but in a negligible amount when compared with the Newman strain (Fig. 1). When the expression levels of ssl5 and ssl8 were compared, they were found to be similar in RN6390 and FPR3757, but ssl8 expression was fourfold higher in the Newman strain compared with ssl5. Interestingly, MW2 had twofold higher ssl8 levels compared with ssl5, whereas MSSA476 showed sevenfold higher ssl5 levels compared with ssl8 levels. In contrast, Mu50 and N315 showed 17- and 10-fold higher ssl5 levels, respectively, compared with their ssl8 expression levels (Fig. 1). The differential expression of both ssl5 and ssl8 in different strains prompted us to see whether different haplotypes of ssl5 and ssl8 are present in these strains and whether they correlated with their differential expression. We sequenced ssl5, ssl8 and their 100 bp upstream regions from the seven clinical strains and various Newman mutant strains used in this study. Because the Newman strain had the highest expression of both ssl5 and ssl8 compared with the other clinical strains tested, the ssl5, ssl8 and their 100 bp upstream sequences obtained were compared with the respective genes of this strain to determine any allelic differences. Based on the respective comparison of ssl5 and ssl8 coding sequences of the seven

strains tested (Table 1), three haplotypes emerged. Haplotype A included Newman, FPR3757, and RN6390 strains; haplotype B included MW2 Seliciclib and MSSA476 strains; and

haplotype C included Mu50 and N315 strains (Figs 2a and 3a). For the ssl5 or ssl8 upstream sequence comparative analysis, three allelic forms were identified for each one. For both ssl5 and ssl8, allelic type A included the same three strains: Newman, FPR3757, and RN6390. However, for ssl5, allelic type B included MW2, MSSA476, and N315, whereas allelic type C included next Mu50 (Fig. 2b). For ssl8, allelic type B included MW2, Mu50, and N315, whereas allelic type C included MSSA476 (Fig. 3b). The ssl5 and ssl8 coding and promoter sequences showed several single nucleotide polymorphisms (SNPs) (Figs 2a, b and 3a, b). These SNPs and the corresponding amino acid change in the coding region were described in Supporting Information, Tables S1 and S2. There was no correlation between haplotypes or allelic types relative to ssl5 or ssl8 expression. The differential expressions of ssl5 and ssl8 within a haplotype with identical upstream sequences in strains such as Newman, RN6390, and FPR3757 suggested that their expression was influenced by additional factors (Fig. 1). Using Newman as the model strain because of its highest expression of ssl5 and ssl8, we determined the role of known regulatory elements, Agr, Sae, and SigB, in their expression.

, 1999). Additionally, the Sec system translocates proteins in a linear state while the Tat pathway exports folded proteins. Tat substrates from different bacteria participate, among other check details functions, in anaerobic metabolism, biofilm formation, cell envelope biogenesis, detoxification and virulence (Lee et al., 2006; De Buck et al., 2008b). The minimal set of components in the Escherichia coli Tat system are three proteins belonging to TatA, TatB and TatC families. The number and copies of each component may differ among bacteria (Dilks et al., 2003). Analysis of the Tat system from an increasing number of bacteria has revealed its

importance for many properties, particularly related to bacteria–eukaryotic host interactions such as plant and animal pathogenesis (De Buck et al., 2008b) and symbiosis between Rhizobium and legumes (Meloni et al., 2003). In this work, we have studied the relevance of the D. dadantii 3937 Tat system for the adaptation of this bacterium to different growth conditions, motility behaviour and interaction with the host plant. The D. dadantii reference strain 3937 (Kotoujansky et al., 1982) was cultivated at 28 °C in nutrient broth (Difco), King’s B medium (KB; King et al., 1954) or basal

medium A (Torriani, 1960). Anaerobic growth was performed using filled screw-cap tubes with medium A with glucose (2 g L−1) instead of glycerol for fermentation, or medium

A plus nitrate (0.5 g L−1) for nitrate respiration. Antibiotics were added to the media at the following concentrations Selleckchem Talazoparib (μg mL−1): ampicillin, 100; carbenicillin, 100; tetracycline, 10 and kanamycin, 20. The D. dadantii 3937 tatABC operon was amplified by PCR with the oligonucleotides TatSense 5′-GGCTGGGTTCCGCAAGACAC-3′ and TatAntisense 5′-CCGTAGTAACAGGACGCATA-3′ corresponding to positions 4626756 and 4622930, respectively, from D. dadantii 3937 genome. The amplified fragment (3846 bp) was cloned in pGEM-T Easy Vector (Promega), resulting in plasmid pTat. Tn7 in vitro mutagenesis was performed on pTat using the genome-priming system kit GPS-1 (New England Biolabs). A mutagenized plasmid bearing the Tn7 transposon within the tatC gene was selected and marker-exchanged Carteolol HCl into the chromosome as described previously (Hugouvieux-Cotte-Pattat & Robert-Baudouy, 1992). The marker exchange was verified by PCR using the former oligonucleotides combined with oligos N and S flanking Tn7 (data not shown). The corresponding D. dadantii tatC mutant (tatC∷Tn7) was named Mtat. Standard molecular cloning techniques used in this study were performed as described previously (Sambrook & Russell, 2001). DNA sequencing of both strands of cloned tatABC was performed using the chain termination method on double-stranded DNA templates using an ABI Prism dye terminator cycle sequencing kit in a Perkin-Elmer 3100 DNA sequencer.