Lancet 1981, i:653–656.CrossRef 27. Erkasap S, Ates E, Ustuner Z, Sahin A, Yilmaz S, Yasar B, et al.: Diagnostic value of interleukin-6 and Creactive protein in acute appendicitis. Swiss Surg 2000,6(4):169–172.PubMedCrossRef 28. Wu HP, Lin CY, Chang CF, Chang YJ, Huang CY: Predictive value of C-reactive protein at different cutoff levels in acute appendicitis. Am J Emerg Med 2005,23(4):449–453.PubMedCrossRef 29. Gronroos JM, Gronroos P: Leukocyte count and Creactive protein in the diagnosis of acute appendicitis. Br J Surg 1999,86(4):501–504.PubMedCrossRef 30. Eryilmaz R, Sahin M, Alimoglu O: The value of C-reactive

protein and leukocyte count in preventing negative appendectomies. Ulus Treuma Derg 2001, 713:142–145. 31. Grönroos JMJU: find more Do normal leukocyte count and C-reactive protein value exclude acute in children? Acta Paediatr 2001,90(6):649–5.PubMedCrossRef 32. Yokoyama S, Takifuji Tozasertib solubility dmso K, Hota T, Matsuda K, Nasu T, Nakamori M, Hirabayashi N, Kinoshita H, Yamaue H: C-Reactive protein is an independent surgical indication marker for appendicitis: a retrospective study. World J of Emergency EPZ015938 Surgery 2009, 4:36.CrossRef 33. Sinanan M, et al.: Acute Abdomen and Appendix. In Surgery; Scientific Principles and Practice. 4th edition. Edited by: Greenfield L. Philadelphia: J.B. Lippincot Company; 2005:1120–1142. 34. Eriksson S, Granstrom

L: Randomized controlled trial of appendicectomy versus antibiotic therapy for acute appendicitis. Br J Surg 1995, 82:166–169.PubMedCrossRef 35. Styrud J, Eriksson S, Nilsson I, Ahlberg , Haapaniemi S, Neovius G, Rex L, Badume

I, Granstrom L: Appendectomy versus antibiotic treatment in acute appendicitis; a prospective multicenter randomized medroxyprogesterone trial. World J Surg 2006, 30:133–137.CrossRef 36. Exadactylos A, Sadowski-Cron C, Mader P, Weissmann M, Dinkel HP, Negri M, Zimmerman H: Decision making in patients with acute abdominal pain at a university and at a rural hospital: does the value of abdominal sonography differ? World Journal of Emergency Surgery 2008, 3:29.CrossRef 37. Leaper DJ, Horrocks JC, Staniland JR, De Dombal FT: Computer-assisted diagnosis of abdominal pain using “estimates” provided by clinicians. Br Med J 1972, 4:350–354.PubMedCrossRef 38. Kessler N, Cyteval C, Gallix B, Lesnik A, Blayac PM, Bruel JM, Taourel P: Appendicitis: Evaluation of sensitivity, specificity, and predictive values of US, Doppler US, and laboratory findings. Radiology 2004, 2:474–478. Competing interests The authors declare that they have no competing interests. Authors’ contributions SX designed the study, carried out acquisition, analysis, interpretation of the data, and drafting of the manuscript. LG-L analyzed histologically the removed appendixes. KX measured the Serum CRP. FV, BB, and FS participated in the study’s design. AK designed the study, was involved in interpretation of the data, the drafting of the manuscript, and revised it critically for the intellectual content until the final version was reached.

Ann Surg 2010, 251:251–258. 93. Hearnshaw SA, Logan RF, Lowe D, Travis SP, Murphy MF, Palmer KR: Acute upper gastrointestinal bleeding in the UK: patient characteristics, diagnoses and outcomes in the 2007 UK audit. Gut 2011, 60:1327–1335.PubMed 94. Lau JY, Barkun A, Fan DM, Kuipers EJ, Yang YS, Chan FK: Challenges in the management of acute peptic ulcer bleeding. Lancet 2013, 381:2033–2043.PubMed 95. Jairath V, Brennan CK, Stanworth SJ: Prevalence, management, and outcomes of patients with coagulopathy after acute nonvariceal upper gastrointestinal bleeding in the United Kingdom. Transfusion 2012. published online Aug 15. doi:10.1111/j.1537 2995.2012.03849.x

96. Wolf AT, Wasan SK, Saltzman JR: Impact of anticoagulation on rebleeding following endoscopic therapy for nonvariceal upper gastrointestinal hemorrhage. this website Am J Gastroenterol 2007, 102:290–296.PubMed 97. Baradarian R, Ramdhaney S, Chapalamadugu R, Skoczylas L, Wang K, Rivilis S, Remus K, Mayer I, Iswara K, Tenner Ganetespib manufacturer S: Early intensive resuscitation of patients with upper gastrointestinal bleeding decreases mortality. Am J Gastroenterol 2004, 99:619–622.PubMed 98. Hwang JH, Fisher DA, Ben-Menachem T: Standards of Practice Committee of the American Society for Gastrointestinal Endoscopy.

The role of endoscopy in the management of acute non-variceal upper GI bleeding. Gastrointest Endosc 2012, 75:1132–1138.PubMed 99. Adamopoulos AB, Baibas NM, Efstathiou SP, Tsioulos DI, Mitromaras AG, Tsami AA, Mountokalakis

TD: Differentiation between patients with acute upper gastrointestinal bleeding who need early urgent upper gastrointestinal endoscopy and those who do not: a prospective study. Eur J Gastroenterol Hepatol 2003, 15:381–387.PubMed 100. Aljebreen AM, Fallone CA, Barkun AN: Nasogastric aspirate predicts high-risk Carbohydrate endoscopic lesions in patients with acute upper-GI bleeding. Gastrointest Endosc 2004, 59:172–178.PubMed 101. Stoltzing H, Ohmann C, Krick M, Thon K: Proton pump inhibitor Diagnostic emergency endoscopy in upper gastrointestinal bleeding. Do we have any decision aids for patient selection? Hepatogastroenterology 1991, 38:224–227.PubMed 102. Rockall TA, Logan RF, Devlin HB, Northfield TC: Risk assessment after acute upper gastrointestinal haemorrhage. Gut 1996, 38:316–321.PubMedCentralPubMed 103. Blatchford O, Murray WR, Blatchford M: A risk score to predict need for treatment for upper-gastrointestinal haemorrhage. Lancet 2000, 356:1318–1321.PubMed 104. Rockall TA, Logan RF, Devlin HB, Northfield TC: Variation in outcome after acute upper gastrointestinal haemorrhage. Lancet 1995, 346:346–350.PubMed 105. Chen IC, Hung MS, Chiu TF, Chen JC, Hsiao CT: Risk scoring systems to predict need for clinical intervention for patients with nonvariceal upper gastrointestinal tract bleeding. Am J Emerg Med 2007, 25:774–779.PubMed 106.

innocua strains, 5 from reference collections, 13 from meat, 8 from milk and 8 from seafoods, and 4 L. welshimeri strains. Listeria strains were retrieved from glycerol stocks maintained at -80°C, and cultured in brain heart infusion broth (BHI; Oxoid, Hampshire, England) at 37°C. YH25448 nmr Carbohydrate fermentation and hemolytic reactions The recommended biochemical patterns for differentiating Listeria spp. included L-rhamnose, D-xylose, D-mannitol and glucose utilization and hemolytic reactivity, and were tested by using

conventional procedures [36, 37]. DNA manipulations Genomic DNA was extracted using a protocol reported previously [12]. Oligonucleotide primers were synthesized by Invitrogen Biotechnology (Shanghai, China) (Table 6 and Additional file 1; table S2), and Taq DNA polymerase (TaKaRa Biotech Co. Ltd., Dalian, China) was used for PCR amplification. PCR was conducted using a PT-200 thermal cycler (MJ Research Inc. MA, Boston, USA), with annealing temperatures depending on specific primer pairs (Table 6 and Additional file 1; table S2), and the duration of extension depending on the expected length of

amplicon (1 min per kb, at 72°C). For DNA sequencing analysis, PCR fragments were purified with the AxyPrep DNA Gel Extraction Kit (Axygen Inc., USA) and their sequences determined by dideoxy method on ABI-PRISM 377 DNA sequencer. Table 6 Primers used for MLST Locus Putative function Locationa Forward primer Momelotinib chemical structure click here Reverse primer Length (bp) gyrB DNA gyrase subunit B 6,031-7,971 TGGTGCATCGGTAGTTAATGC CAACATCTGGGTTTTCCATCAT 657 dapE Succinyl diaminopimelate desuccinylase 301,402-302,538 GTAAATATTGATTCGACTAATG CACTAGCACTTGTTTCACTG 669 hisJ Histidinol phosphate phosphatase 606,408-607,235 TCCACATGGTACGCATGAT GGACATGTCAAAATGAAAGATC

714 sigB Stess responsive alternative sigma factor B 924,734-925,513 CCAAAAGTATCTCAACCTGAT CATGCATTTGTGATATATCGA 642 ribC Riboflavin kinaseand FAD synthase 1,364,536-1,365,480 AAGACGATATACTTACATCAT GTCTTTTTCTAACTGAGCA 633 purM Phosphoribosyl aminoimidazole synthase 1,893,107-1,894,153 CAAGCTCCACTTTGACAGCTAA TAAAGCAGGCGTGGACGTA 693 betL Glycine betaine transporter 2,216,882-2,218,405 ACAGAACATTATCCAAATGAGTT ACGTTGTGATTTTTTCGGTC 534 gap find more Glyceraldehyde 3-phosphate dehydrogenase 2,578,558-2,579,584 CTGGATCAGAAGCTGCTTCCA GTCGTATTCAAAATGTGGAAGGA 621 tuf Translation elongation factor 2,816,958-2,818,145 CATTTCTACTCCAGTTACTACT GCTCTAAACCCCATGTTA 681 Subtotal         5,844 a, Positions correspond to complete genome sequence of L. innocua strain CLIP11262 (AL592022). Internalin profiling By sequence comparison of L. monocytogenes strains F2365, H7858 (serovar 4b), EGDe and F6854 (serovar 1/2a) and L. innocua strain CLIP11262, we investigated the presence or absence of 14 L. monocytogenes-L. innocua-common and 4 L. innocua-specific internalin genes as well as 19 L. monocytogenes-specific internalin genes by PCR with specific primers outlined in Additional file 1; table S1.

3 mM (10.2 mg/l) H2O2 caused complete inhibition that lasted for nearly 16 h, whereas 0.3 mM (10.2 mg/l) H2O2 alone had no effect. However, if no more H2O2 was added, the concentration of the inhibitor OSCN- Nec-1s concentration fell because of slow decomposition of OSCN-, and, when OSCN- fell below 0.01 mM (0.74 mg/l), the bacteria resumed metabolism and growth. The loss of OSCN- over time is based

on decomposition, not on the reaction with bacteria [29]. The typical concentration of peroxidases in whole saliva is roughly 5 μg/ml, whereas the MPO concentration (3.6 μg/ml) is approximately twice the amount of SPO (1.9 μg/ml) [30]. Therefore, even if SPO is deficient, MPO activity would probably be adequate for SCN- oxidation in mixed saliva [30]. The study by Adolphe et al. [31] showed that the lactoperoxidase system’s antimicrobial efficiency can be enhanced by better concentration ratios of the LPO SU5402 cost system components. However, this finding was

postulated for only near physiological conditions and did not consider a concentration of thiocyanate Quisinostat datasheet and H2O2 higher than the physiological one. Rosin et al. [32] showed that, in the saliva peroxidase system, increasing SCN-/H2O2 above its physiologic saliva level reduced plaque and gingivitis significantly compared to baseline values and a placebo. A new dentifrice formulated on these results showed the same effects regarding plaque and gingivitis prevention in comparison to a benchmark product containing triclosan [33]. However, the effects were not sufficient to recommend using the SPO system to effectively prevent oral diseases in the long run. Thus, the question arose, Is it possible to increase antimicrobial effectiveness by adding not just Farnesyltransferase thiocyanate and hydrogen peroxide but also LPO to oxidize as much the SCN- anions as possible to become an effective antimicrobial agent? Therefore, we conducted a standardized quantitative suspension test at a fixed concentration level of all three components above the physiological one to evaluate the influence of LPO on the lactoperoxidase-thiocyanate-hydrogen peroxide system relative to its bactericidal and fungicidal effectiveness against Streptococcus mutans and sanguinis and Candida albicans. Results

The reduction factors (RF) of the test suspensions without and with LPO on the viability of Streptococcus mutans, Streptococcus sanguinis, and Candida albicans at different time points (1, 3, 5, and 15 min) are shown in tables 1, 2 &3. Table 1 Reduction factors of the test thiocyanate hydrogen peroxide microbial suspension without and with LPO to Streptococcus mutans at different time points.   Group A Group B A vs. B2   Without LPO With LPO   Time Reduction factor Comparisons within A1 Reduction Factor Comparisons within B1       1 vs. 3 3 vs. 5 5 vs. 15   1 vs. 3 3 vs. 5 5 vs. 15   [min] Mean ± SD p p p Mean ± SD p p p p 1 0.23 ± 0.26       0.03 ± 0.17       0.128 0.844 0.016                 3 0.21 ± 0.36       0.53 ± 0.22       0.026 0.375 0.

(a) Minor

hysteresis loop of the Co nanowires/InP membrane composite obtained by VSM measurement at α = 0° (H || z) and (b) at α = 90° (H ⊥ z). For α = 0°, the hysteresis losses of the 0.5 and 1 kOe minor loops are significantly higher compared to the corresponding minor loops for α = 90°. The same behavior is found for the maximum normalized magnetization. This behavior suggests that the easy magnetization direction of the Co nanowires lies along the long nanowire axis z (α = 0°) due to the high aspect ratio of the Co nanowires giving rise to a pronounced shape anisotropy that exceeds the magnetocrystalline anisotropy of selleckchem Co [23]. The remanence squareness of 0.07 found for the easy magnetization direction is very low compared to a single

nanowire with the magnetization also along selleck products the long nanowire axis z [24]. One could understand this behavior by taking into account the nucleation of domains with inverse magnetization at the bottom or at the top of the Co nanowires. These domains with inverse magnetization could efficiently reduce stray fields and might be also the reason for the reduced the remanence squareness. The magnetostatic interactions between AZD8931 clinical trial neighboring Co nanowires might also play an important role, since the interwire distance is far smaller compared to the diameter of the Co nanowires. Another interesting effect is that for external magnetic fields H a larger than 500 Oe, the minor loops show a distinct hysteresis that disappears completely for very small H a (20 and 100 Oe). These minor loops show a reversible linear magnetic field dependence with a higher slope observed for α = 0°. The reversible linear magnetic field dependence means that the magnetization reversal at very small fields H a occurs by domain rotation Bay 11-7085 and reversible domain wall motion and not by irreversible domain wall motion as observed for higher external fields. The angular dependence of the coercivity

is presented in Figure 4b. The coercivity shows a completely different angular behavior. It is smallest for α = 0° (around 150 Oe) and increases constantly to about 210 Oe for α = 60°, where it peaks for α = 60° and α = 75° before it slightly decreases to around 205 Oe for α = 90°. The magnified view on the differential normalized susceptibility χ norm around H = 0 Oe – depicted in Figure 4c – shows an inverse angular behavior with respect to the maximum χ norm. With increasing angle α, the maximum χ norm decreases steadily from about 0.43/kOe for α = 0° reaching a plateau at about 0.3/kOe for α = 75° and α = 90°. In addition to that, two characteristic peak positions are observed represented by the two solid lines at around 160 Oe and by the two dashed lines at around 280 Oe.

The major failure mechanism in thermal

barrier coatings (TBCs) is the formation of a thermally grown oxide (TGO) layer at the bond coat/zirconia interface. The introduction of single-layer alumina or graded alumina/zirconia interlayer offers a potential solution to this problem by incorporating an oxygen diffusion barrier into the TBC system, thereby reducing the TGO growth rate [13]. By controlling the oxide/TBC interface formation, better adhesion and minimum thermal stresses could be achieved [14]. Pulsed laser deposition (PLD) is quite easy to produce multilayer films composed of two or more materials. One of the major advantages is that the stoichiometry of the target can be retained PLK inhibitor in the deposited films. This is due to the high rate of ablation, which causes all the elements to evaporate at the same time [15, 16]. The present work has focused on the development of Al2O3/ZrO2 nanolaminate thin films in order to stabilize the tetragonal phase of zirconia at room

temperature as a function of ZrO2 layer thickness. Methods Al2O3 (99.99% purity) and ZrO2 (99.99%) pellets of approximately 25 mm in diameter and approximately GSK126 concentration 3 mm in thickness were prepared and sintered at 1,673 K for 6 h and used as targets for PLD. The deposition was performed using KrF excimer laser (λ = 248 nm), and other deposition parameters were reported elsewhere [17, 18]. Si (100)-oriented substrates of dimension 10 mm × 10 mm × 0.5 mm (n-type phosphorous doped with a resistivity of 20 to 30 Ω cm) were used for the deposition of films. Multilayers, which consist of Al2O3 and ZrO2, of 10:10, 5:10, 5:5, and 4:4 nm with 40 bilayers were deposited at an optimized oxygen

partial pressure of 3 Pa at room temperature. Before the deposition of the multilayers, deposition rates of the individual layers MTMR9 were determined accurately by measuring the thickness of each layer using a Dektak profilometer (Dektak 6M Stylus Profiler, Veeco, Plainview, NY, USA). All the multilayer samples were analyzed by conventional X-ray diffraction (XRD; INEL XRG–3000 Diffractometer, Artenay, France). High-temperature XRD (HTXRD; INEL XRG–3000 Diffractometer attached with a curved position-sensitive detector and Bühler 2.4 HDK high-temperature camera, Hechingen, Ispinesib cost Germany) was performed to study the structural changes in the 5:5-nm film as a function of temperature in the range 298-1,273 K. A Pt-Re thermocouple was used for measuring the temperature of the sample. A heating rate of 10 K/min, cooling rate of 25 K/min, and soaking time of 5 min were used. The patterns were recorded in steps of 100 K, in vacuum of the order of approximately 2 × 10−3 Pa for 30 min. For the cross-sectional transmission electron microscopy (XTEM) analysis, the specimen (10 mm × 10 mm × 0.5 mm) was cut into small rectangular pieces using a wire saw. Two of these were glued, making the film surface face-to-face with a special adhesive and cured at 130°C for 1 h.

A value of P < 0.05 was considered to be statistically significant. 3. Results 3.1 Measurement of Zfx mRNA in U251 cells, U87 cells, U373 cells, and A172 cells We detected the expression of Zfx mRNA in glioma cell lines U251, U87, U373, and A172 by semi-quantitative RT-PCR. Zfx mRNA was expressed in all four cell lines (Figure 1). Figure 1 The expression of Zfx mRNA in the four glioma cell lines was measured by Semi-quantitative RT-PCR. The symbols are: U251-U251 cells, U87-U87 cells, U373-U373 cells, and A172-A172 cells. A constitutively see more expressed Gapdh gene was used as an internal control. 3.2 The relative expression levels of Zfx mRNA in glioma

tissue samples and noncancerous brain tissue samples In order to examine whether there is a significant selleck compound difference in the expression of Zfx mRNA in glioma tissue compared to noncancerous brain tissue, we performed real-time quantitative PCR. Zfx mRNA is elevated in gliomas compared to noncancerous brain tissue (Figure 2A). We identified correlation between glioma malignancy and Zfx mRNA expression. However, this was not the case for Grade III and Grade IV (Figure 2B). Figure 2 The expression level of Zfx mRNA in the glioma samples and the noncancerous brain tissue detected by real-time quantitative PCR. (a) The higher

expression level of Zfx in all glioma samples (including the Grade I to Grade IV) versus the noncancerous brain tissue. (p = 0.01). (b) The expression level of each grade glioma versus the noncancerous brain tissue. *P < 0.05. 3.3 The interference efficiency of the template was detected by Western blot analysis 293T NVP-BSK805 solubility dmso cells were infected with Zfx-siRNA lentivirus or NC lentivirus. As shown in Figure 3, Zfx protein level detected by Western blot was greatly reduced in Zfx-siRNA infected cultures,

indicating effective knockdown of the PTK6 target sequence. Figure 3 Protein of Zfx in 293T cells measured by western blot. Compared with NC, the level of Zfx protein in 293T cells decreased markedly after Zfx expression was silenced by RNAi. Gapdh is a control. 3.4 Lentivirus-mediated knock-down of Zfx in the human malignant cell line U251 To begin to explore the role of Zfx, we knocked down Zfx levels in the human malignant cell line U251. As shown in Figure 4, by 3 days after infection, efficiencies were greater than 80% for both Zfx-siRNA lentivirus and NC lentivirus. There was no significant difference between the negative control cells and the nontransfected cells, indicating that the transfection process itself had no effect on cell growth. Zfx mRNA levels in U251 cells at 5 days after infection with Zfx-siRNA lentivirus and NC lentivirus were assessed by real-time PCR. Zfx-siRNA lentivirus infected cultures had significantly lower levels of Zfx mRNA compared to levels in cultures infected with NC lentivirus (Table 1 and Figure 5).

The content of GLC and FRU in leaves was evaluated by measuring the NADPH absorption after successive additions of the coupling enzymes glucose-6-P-dehydrogenase, hexokinase, phosphoglucose-isomerase and invertase [19] using a UV/visible spectrophotometer (Tecan GENios Microplate Reader, Männedorf, Switzerland) at 340 nm. AA was estimated by a colorimetric this website 2.6-dichlorophenol-indophenol (DIP) method [20]. The AA content was estimated using a UV/visible spectrophotometer (Novaspec II, Selleck Napabucasin Pharmacia Biotech AB, Uppsala, Sweden) at 520 nm. CA content was determined by measuring the NADH oxidation after addition of l-malate dehydrogenase, l-lactate dehydrogenase, oxaloacetate and pyruvate [21]

using a UV/visible I-BET-762 datasheet spectrophotometer (Novaspec II, Pharmacia Biotech AB, Uppsala, Sweden) at 340 nm. Finally, according to Marinova et al. [22], PP leaf content was determined following a modified Folin-Ciocalteu method [23]. After incubation, the absorbance of the leaf extracts was determined using a UV/visible spectrophotometer (Novaspec

II, Pharmacia Biotech AB, Uppsala, Sweden) at 750 nm. The enzymatic test kit was purchased from R-Biopharm AG (Darmstadt, Germany). Data analysis Plants were arranged in a randomized design (nine plants per species per treatment, one plant per pot). One-way analysis of variance (ANOVA) was carried out to test the differences in the plants’ behaviour. The statistical significance of differences between mean values was determined using Bonferroni’s test (p < 0.05). Different letters in Tables 1 and 2 are used to indicate means that were statistically different at p < 0.05. Statistical analysis was performed using the SPSS program (ver. 17, SPSS Inc.,

Chicago, IL, USA). Table 1 Concentration of Ag in the roots, stems and leaves of the plants and Ag TF Species Ag roots Ag stem Ag leaves Translocation factor Methocarbamol (mg kg−1 DW) (mg kg−1 DW) (mg kg−1 DW) (× 100) Brassica juncea 82,292 a 57,729 a 6,156 a 7.48 a (5,394) (598) (516) (0.92) Festuca rubra 62,365 b 2,777 c 2,459 b 3.94 b (1,990) (2,738) (258) (0.36) Medicago sativa 19,715 c 25,241 b 4.31 c 0.022 c (2,369) (5,004) (0.84) (0.003) The means (n = 3) with the same letter were not significantly different (Bonferroni’s test; p < 0.05). The mean standard error (n = 3) is in brackets. TF, translocation factor; DW, dry weight. Table 2 Content of GLC, FRU, AA, CA and PP in the leaves of the plants Species GLC FRU AA CA PP (mmol kg−1 FW) (mmol kg−1 FW) (mg kg−1 DW) (mg kg−1 DW) (mg GA Eq. 100 g−1 DW) Brassica juncea 1.61 b 2.17 b 3,878 a 10.2 a 711 a (0.64) (1.07) (548) (0.48) (48.6) Festuca rubra 70.4 a 57.8 a 119 c 11.2 a 580 b (12.9) (14.7) (92.4) (2.59) (37) Medicago sativa 8.17 b 7.37 b 1459 b 5.12 a 528 b (0.58) (0.57) (359) (1.68) (18.9) The means (n = 3) with the same letter were not significantly different (Bonferroni’s test; p < 0.05). The mean standard error (n = 3) is in brackets.

Characterization The morphology and size

distribution of the products were characterized by a LEO-1530 field-emission SEM (Carl Zeiss AG, Oberkochen, Germany) with an accelerating voltage of 20.0 kV. Chemical composition of the specimens was analyzed using an EDS as attached on the SEM. Structural quality of the nanowire arrays was evaluated by an X’Pert PRO XRD (PANalytical Instruments, Almelo, Netherlands) with Cu Kα radiation (λ = 1.54056 Å). The PL spectra of the samples were collected on a Hitachi F-7000 fluorescence spectrophotometer (Hitachi, Tokyo, Japan) with an excitation wavelength of 325 nm. Optical reflectance measurements were performed on an Agilent Evofosfamide solubility dmso Cary-5000 UV-vis-NIR spectrophotometer (Agilent Technologies, Sta. Clara, CA, USA). All the measurements were carried out at room temperature in normal conditions. Results and discussion The structural evolution of the as-grown specimens that underwent Ruxolitinib order 30-min chemical etching and 2-h hydrothermal

growth (S30Z2) is presented in the right panels of JNK-IN-8 datasheet Figure 1. It can be seen that after chemical etching in step 1 (Figure 1e), free-standing Si nanowire arrays in a wafer scale are produced on the substrate surface in a vertical alignment. The Si nanowire arrays have a length of about 2.5 μm and a diameter ranging between 30 and 150 nm. The growth rate of the nanowire length is about 1.4 nm/s and almost keeps constant for different durations. The structure, growth rate, and diameter of the Si nanowires are primarily restricted by the components and concentration of etching solution, as corroborated by the following experiments. A layer of ZnO nanoparticles is subsequently deposited on the Si nanowire array in step 2 (Figure 1f). Due to the isotropic characteristic of the sputtering system, the ZnO nanoparticles conformally coat on the nanowires and induce a rough sidewall surface. After hydrothermal growth in step 3 (Figure 1g), branched ZnO nanowires grow hierarchically on the surface of the Si nanowires, which fills up the space between the Si nanowires these and presents a flower shape on each Si nanowire tip for the radial growth.

The heterogeneous nanowire structure is more obvious in the magnified and cross-sectional SEM images in Figure 2. The branched ZnO nanowires grow nearly in the normal direction to the Si nanowire surface. They have a hexagonal cross section and grow along the c axis of the wurtzite crystal. This is also confirmed by the following XRD pattern of the specimen. The distribution of ZnO nanowires seems non-uniform over the Si nanowire surface, which may be due to the non-uniformity of Si nanowire diameters from the chemical etching and the uneven coating of ZnO seed layer from sputtering. The mean diameter of ZnO nanowires is around 35 nm and is almost independent to the site of the Si nanowires. However, the length of ZnO nanowires is strongly dependent on the nanowires’ location.

The largest R s (17.02 Ω) of kesterite CZTS CE can be attributed to the strong ligand of oleylamine on the CZTS NC surface. Similarly, some organic substance capped on the surface of the wurtzite CZTS NCs made the R s (16.2 Ω) of wurtzite CZTS CE higher than that (15.91 Ω) of Pt CE. However, the value of R ct (2.78 Ω) of the wurtzite CZTS CE is lower than that of Pt (2.92 Ω) and kesterite CZTS (3.56 Ω). The smallest R ct for wurtzite CZTS CE JNJ-26481585 implies that it has eximious catalytic activity on the reduction of triiodide and supersedes the expensive Pt as the CE in DSSCs.

The conclusions for the catalytic activity derived from the EIS and CV data are consistent. Figure 4 Nyquist plots for different CEs. The test was performed with the symmetrical

cells fabricated with two identical electrodes. Figure 5 Current density-voltage ( J – V ) curves of DSSCs based on different CEs A-1331852 ic50 under AM 1.5 (100 mW cm Selleck Lorlatinib -2 ). Figure 5 shows the photocurrent density-voltage (J-V) curves of these DSSCs with different CE materials, and the detailed photovoltaic parameters are summarized in Table 1. For the DSSC using the kesterite CZTS CE material, the power conversion efficiency (η) of the device was relatively low (4.89%), since the data of photovoltaic parameters such asJ sc, V oc, and FF were low (J sc = 10.20 mA/cm2, V oc = 0.73 V, FF = 65.72%, respectively). For the wurtzite CZTS CE material, the efficiency of the DSSC device was high ifoxetine (6.89%); the high performance resulted from the improved photovoltaic parameters, such asJ sc, V oc, and FF (J sc = 13.41 mA/cm2, V oc = 0.75 V, FF = 68.69%, respectively). The efficiency of the DSSC using

wurtzite CZTS CE was even better than that of Pt CE (η = 6.23%, J sc = 11.43 mA/cm2). The values of V ocwere almost constant in these DSSC devices using different CE materials. The difference of the efficiency of DSSC devices mainly resulted from the parameters of J sc and FF. The high FF of the wurtzite CZTS CE may be attributed to its relatively low R s[32]. The highest J sc for wurtzite CZTS should come from its high carrier concentration and low resistivity. According to our previous result, the Hall effect measurement demonstrated that compared to the kesterite CZTS films, the wurtzite CZTS films show a higher carrier concentration and lower resistivity [18]. Wurtzite CZTS is a hexagonal crystal system and metastable; perhaps, this structure is beneficial for catalysis and charge conductivity. The J-V results signify that the wurtzite CZTS could be a somewhat economical and effective CE material for DSSC. Conclusions In this work, we used the wurtzite and kesterite CZTS NC films as effective CEs in DSSCs. The measurement of the photovoltaic performance of DSSCs showed that the wurtzite CZTS CE exhibited higher solar energy conversion efficiency (6.89%). The results of CV and EIS demonstrated the superior electrocatalytic activity of the wurtzite CZTS NC films.